Genomics & Bioinformatics Core Facility

DNA Sanger Sequencing Full Service

Full-Service option includes DNA Sanger reaction preparation and Sequencing. For sequencing of plasmids or purified PCR products, submit your template and custom primer in separate labeled tubes according to our Sample Preparation Guidelines. Please note sample tubes and primer tubes are discarded after sequencing is complete and after data is delivered.

Looking for resources to help you troubleshoot your DNA sequencing reactions? Please see our Troubleshooting Resources page. 


Submitting Your Order

Genomics Core Facility manages all DNA Sanger Sequencing Service using two interfaces: CORES Ordering System and Sample Information Form
For 2- to 3-day business day service, enter your order into the CORES Ordering System and send your Full Service Sample Information Form to genomics@nd.edu by 12:00PM, and samples must be delivered to our faclity by 2:00PM. 

CORES

Need to set-up a new resource user in CORES?: Resource Guides are available from the Facilities and Resouces Page of Notre Dame Research.

Order Entry:

  1. Login to CORES.
  2. From the Order Entry Panel, enter into the field your Last Name or FOP. Click Search button.
  3. Select the appropriate CORE Facility: Genomics Core Facility - Pfrender, Michael
  4. Select the appropriate FOP from the list.
  5. Complete the Order Entry –Item Information:
    1. Select the Category from the drop-down menu
    2. Select the Description from the drop-down menu
    3. Enter the quantity.
  6. Click Add Item button to entry additional items to the same order, and then repeat step 5.
  7. REQUIRED: Purchaser’s Information must be populated with your Last Name, First Name, email address, and phone number.
    1. Choose your own name from the Purchaser's drop down menu. If your name is not populated in the drop down, replace the default Last Name and First Name fields with your information. When the order is submitted, data will be delivered to the Purchaser Listed. Failure to complete the Purchaser’s Information will delay sample processing.
  8. Review your Order Entry. Be sure all information is accurate and the Purchaser’s Information correct.
  9. Click Submit Order Request.

Full Service Sample Information Form

  1. Download Full Service Sample Information Form for DNA Sanger Sequencing.
  2. Send your completed form to genomics@nd.edu by 12:00PM for 2- to 3-day business day service.

Sample Delivery

To avoid sample-processing delays, ensure your tubes/plates are clearly labeled with your initials, date, and sample number. Deliver your samples to our Genomics Core Facility by placing them in our designated DNA Sanger Sequencing freezer. Please note sample tubes/plates and primer tubes are discarded after data is delivered.

Deliver your samples by no later than 2:00PM (EST-D) to our facility:

Genomics Core Facility
Galvin Life Science Center Room 019
Phone: (574) 631-1902

Sample Preparation Guidelines:

  1. For orders with <24 samples, please use 1.5ml tubes. Label your tube on the side with your initials and date. Label the top lid of your tube with your initials and samples number. 
    • For orders with 24 to 48 samples, please use 8-strip PCR tubes to streamline sample processing. Label the strip with your initials, date, and sample number.
    • For orders with >48 samples, you may use a labeled 3730xl-compatible 96-well plate. Label the plate with your initials and date . For a list of 3730xl-compatible 96-well plates, please see the AB3730xl Compatible Plates section.
  2. Dilute your sequencing primer to 10uM (pmol/µl) using water. You will need 2ul of primer for each sequencing reaction. Select commercial primers are available at no additional charge. Remember only one primer is used in a sequencing reaction. Forward and reverse reactions are considered two (2) separate reactions and billed as such.
  3. For the amount of DNA template required for DNA Sanger Sequencing Service, please see the table. Please dilute the DNA template to the concentration listed in the table, and submit the required volume of DNA template and required volume of primer to avoid sample-processing delays. 
  4. Commercial primers are available upon request. Please indicate in the Sample Submission Form the desired commercial primer for each DNA template.

Commercial Primer Name
Sequence (5'-3')
M13F
GTAAAACGACGGCCAGT 
M13R
CACACAGGAAACAGCTATGACCAT
T7
TAATACGACTCACTATAGGG
T7term
GCTAGTTATTGCTCAGCGG
T3
AATTAACCCTCACTAAAGGGA
SP6
ATTTAGGTGACACTATAG
pGEX-F
CTGGCAAGCCACGTTTGGTG
pGEX-R
GGAGCTGCATGTGTCAGAGG

IF providing separate tubes, provide template and your custom primer according to the table. 

DNA Template Primer
Type

Fragmetn Length

Concentration

Volume
Per Reaction

Concentration µM
(pmol/µl)

Volume
Per Reaction

Plasmid > 2,000 bp 100 ng/µl 2 µl 10 µM 2 µl

Purified PCR Products

 

up to 200 bp 3.0 ng/µl 3 µl 10 µM 2 µl
200 - 500 bp 5.0 ng/µl 3 µl
500 - 1,000 bp 10.0 ng/µl 3 µl
 >1,000 bp 40.0 ng/µl 3 µl

IF providing a 96-well plate, provide template (1 µl for each well) and your custom primer (1 µl for each reaction) according to the table.

DNA Template Primer
Type

Fragment Length

Total Mass
Per Reaction

Volume
Per Reaction
Concentration µM
(pmol/µl)

Volume
Per Reaction

Plasmid > 2,000 bp 150 ng 1 µl 10 µM 1 µl

Purified PCR Products

 

up to 200 bp 3 ng 1 µl 10 µM 1 µl
200 - 500 bp 10 ng
500 - 1,000 bp 20 ng
> 1,000 bp 50 ng

AB3730 Compatible 96-well Half-Skirted Plates

Distributor Dist. Catalog Description
Dot Scientific, Inc. 351-PCR PCR PLT 96W 0.2ML HS NAT PRINTED AXIS 10/PK
ThermoFisher Scientific AB1400 Thermo Scientific 96-Well Semi-Skirted Plates, Flat Deck

Getting Your Results 

Sanger sequencing data files are posted to Google Drive. Need permission to access your files? Reach out to us by completing our Sanger Sequencing Request Access Form
 
If you have questions about your sanger data files, please contact Genomics Core Facility at 574-631-1902 or genomics.nd.edu.
Working in Google Drive
For additional information, Google Drive quick-reference guides and resources are available to help you get started.
 
Want to map your computer directly to your Sanger Sequencing data folder? You will need to add the shared folder to your "My Drive" first and then install Google File Stream on your computer by following these instructions
 
If you have any questions about Google Drive, please contact your departmental IT support staff, or OIT Help Desk at 574-631-8111, oithelp@nd.edu or chat online at: help.nd.edu.
 
Viewing Your Results

Sanger Sequencing Software

Applied Biosystems Sequence Scanner Software v2.0 (Download)
Operating System: Windows 7
Description: View, edit, print and export data generated using AB37030XL and other Applied Biosystesms Genetic Analyzer instruments. 

QIAGEN CLC Sequence Viewer (Download)
Operating System: Windows Vista, Windows 7, Windows 8, Windows 10, Windows Server 2008, or Windows Server 2012; Mac OS X 10.7 or later
Description: View, edit, and manipulate data generated using AB37030XL and other Applied Biosystems Genetic Analyzer instruments. For a complete list of features, click here

Sequencer 5.1 (Download)
(Notre Dame Faculty / Staff / Students only)
Operating System: Windows; Mac OS X
Description: View, edit, print and export data generated using AB37030XL and other Applied Biosystesms Genetic Analyzer instruments.
Required Utility Software:  To run Sequencher, KeyAccess client must be installed. Downolad here.
Remote Access Uility Software: To remotely access Sequencher, Cisco Clean Access VPN connection is required when off-campus. Download here.
 

Resources

Full Service Sample Information Form

Sequencing Failed Reaction(s) / Redo Policy

If the full service sequencing reaction produces ambiguous results, you may request for us to rerun the sample(s). When repeating the reaction, the sample tube(s) and primer(s) used must be the same used in the intial reaction. If the reaction(s) produces a better result, then there is no additional cost to you. However, if the reaction fails to produce a different result, you will be charged for second attempt.