Genomics & Bioinformatics Core Facility

DNA Sanger Sequencing Full Service

Our Full-Service option includes DNA Sanger reaction preparation and Sequencing. For sequencing of plasmids or purified PCR products, submit your template and custom primer in separate labeled tubes according to our Sample Preparation Guidelines. Please note sample tubes and primer tubes are discarded after sequencing is complete and after data is delivered.

Looking for resources to help you troubleshoot your DNA sequencing reactions? Please see our Troubleshooting Resources page. 


Order Submission Guidelines

Genomics Core Facility manages all DNA Sanger Sequencing Service using two interfaces: CORES Software and Order Submission Form. Please follow all Order Submission instructions as detailed for Full-Service to avoid sample-processing delays. For 2- to 3-day business day service, the CORES Order and Order Submission Form must be submitted to genomics@nd.edu by 12:00PM, and samples must be delivered to our faclity by 2:00PM. 

CORES Order Entry

NEED TO SETUP A NEW RESOURCE USER IN CORES: Instructions and Contact information are found on the CORES HOMEPAGE.

  1. Login to CORES by click here or copy/paste the website into your web-browser: https://cores-nd.mis.vanderbilt.edu/rolemorph.cfm
  2. From the Order Entry Panel, enter into the field your Last Name or FOP. Click Search button.
  3. Select the appropriate CORE Facility: Genomics Core Facility - Pfrender, Michael
  4. Select the appropriate FOP from the list.
  5. Complete the Order Entry –Item Information:
    1. Select the Category from the drop-down menu
    2. Select the Description from the drop-down menu
    3. Enter the quantity.
  6. Click Add Item button to entry additional items to the same order, and then repeat step 5.
  7. REQUIRED: Purchaser’s Information must be populated with your Last Name, First Name, email address, and phone number.
    1. Choose your own name from the Purchaser's drop down menu. If your name is not populated in the drop down, replace the default Last Name and First Name fields with your information. When the order is submitted, data will be delivered to the Purchaser Listed. Failure to complete the Purchaser’s Information will delay sample processing.
  8. Review your Order Entry. Be sure all information is accurate and the Purchaser’s Information correct.
  9. Click Submit Order Request.

Order Submission Form

  1. To download the current order forms for DNA Sanger Sequencing, click here.
  2. Follow all instructions on the DNA Sanger Sequencing Order Submission Form.
  3. Follow the Sample Preparation Guidelines for either Full-Service or Ready-to-Run Service. Please dilute the DNA template to the concentration listed in the table, and submit the required volume of DNA template and required volume of primer to avoid sample-processing delays.
  4. Email your Order Submission Form to genomics@nd.edu by 12:00PM for 2- to 3-day business day service.

Sample Preparation Guidelines:

  1. For orders with <24 samples, please use 1.5ml tubes. Label your tube on the side with your initials and date (MM/DD/YYYY). Label the top lid of your tube with your initials and samples number.
    1. For orders with 24 to 48 samples, please use 8-strip PCR tubes to streamline sample processing. Label the strip with your initials, date (MM/DD/YYYY), and sample number.
    2. For orders with >48 samples, please use a labeled 3730xl-compatible 96-well plate. Label the plate with your initials and date (MM/DD/YYYY). For a list of 3730xl-compatible 96-well plates, please see the AB3730xl Compatible Plates section.
  2. Dilute your sequencing primer to 10uM (pmol/µl) using water. You will need 2ul of primer for each sequencing reaction. If you want a commercial primer, we do have a select catalog available and will provide it at no additional charge. Remember only one primer is used in a sequencing reaction. Forward and reverse reactions are considered two (2) separate reactions and billed as such.
  3. For the amount of DNA template required for DNA Sanger Sequencing Service, please see the table. Please dilute the DNA template to the concentration listed in the table, and submit the required volume of DNA template and required volume of primer to avoid sample-processing delays. 
  4. Commercial primers are available upon request. If you want a commercial primer, we do have a select catalog available and will provide it at no additional charge. Please indicate in the Sample Submission Form the desired commercial primer for each DNA template.

Commercial Primer Name
Sequence (5'-3')
M13F
GTAAAACGACGGCCAGT 
M13R
CACACAGGAAACAGCTATGACCAT
T7
TAATACGACTCACTATAGGG
T7term
GCTAGTTATTGCTCAGCGG
T3
AATTAACCCTCACTAAAGGGA
SP6
ATTTAGGTGACACTATAG
pGEX-F
CTGGCAAGCCACGTTTGGTG
pGEX-R
GGAGCTGCATGTGTCAGAGG

In separate tubes, provide template and your custom primer according to the table. 

DNA Template Primer
Type

Length (include vector)

Concentration

Volume Per Reaction

Concentration µM (pmol/µl)

Volume Per Reaction

Plasmid 2 kb or longer 150 ng/µl 2 µl 10 µM 2 µl

Purified PCR Products

 

<100 bp 1.0 ng/µl 2 µl 10 µM 2 µl
100 - 200 bp 1.0 ng/µl 4 µl
200 - 500 bp 3.0 ng/µl 5 µl
500 - 1000 bp 5.0 ng/µl 6 µl
1000 bp – 2000 bp 10.0 ng/µl 6 µl
2000 bp or longer 40.0 ng/ul 4 µl

In the plate wells, provide template (1 µl for each well) and your custom primer (1 µl for each reaction) according to the table.

DNA Template Primer
Type

Length (include vector)

Concentration

Total Mass Per Reaction

Volume Per Reaction Concentration µM (pmol/µl)

Volume Per Reaction

Plasmid 2 kb or longer 150 ng/µl 150 ng 1 µl 10 µM 1 µl

Purified PCR Products

 

<100 bp 2.5 ng/µl 2.5 ng 1 µl 10 µM 1 µl
100 - 200 bp 3.0 ng/µl 3 ng
200 - 500 bp 10.0 ng/µl 10 ng
500 - 1000 bp 20.0 ng/µl 20 ng
1000 bp – 2000 bp 40.0 ng/µl 40 ng
2000 bp or longer 50.0 ng/ul 50 ng

AB3730 Compatible 96-well Half-Skirted Plates

Distributor Dist. Catalog Description
Dot Scientific, Inc. 351-PCR PCR PLT 96W 0.2ML HS NAT PRINTED AXIS 10/PK
VWR  89126-694 96-Well PCR Plates, Neptune
Applied Biosystems 4316813 MicroAmp Fast Optical 96-Well Reaction Plate (0.1 mL)
ThermoFisher Scientific AB1400 Thermo Scientific 96-Well Semi-Skirted Plates, Flat Deck
ThermoFisher Scientific NC9009219 USA Scientific Inc  TEMPLATE III PCR 

Sample Submission

Please follow all instructions as detailed in the Sample Preparation Guidelines for Full-Service or Ready-to-Run Service. To avoid sample-processing delays, ensure your tubes/plates are clearly labeled with your initials, date, and sample number. Deliver your samples to our Genomics Core Facility by placing them in our designated DNA Sanger Sequencing freezer. Please note sample tubes/plates and primer tubes are discarded after sequencing is complete and after data is delivered.

Deliver your samples by no later than 2:00PM (EST-D) to our facility:

Genomics Core Facility
Galvin Life Science Center Room 019
Phone: (574) 631-1902

 

Results

For each DNA samples, two files are generated: *.abi file and *.seq file. Both files will be copied to and accessible from the Genomic Data Folder for your laboratory.

Failed Reaction(s) Policy

We agree to re-run failed reactions using the same template and primers, upon your request. If the reaction fails again, you will be charged for both the initial reaction and the second requested reactions. Otherwise, you will be charged only for the successful reaction.

Getting Your Results

To retrieve your results and data files, access the Genomic Data Folder for your laboratory. To access this folder, follow the instruction of how to map a network drive.

For Windows Operating Systems 7 or higher

  1. Begin from the Start Menu Button, and select File Explorer. A prompt window will open.
  2. From the top of the prompt window, click on the Tools Menu, and then select Map Network Drive. A prompt window will open.
  3. Within the Map Network Drive Window, select a Drive Letter from the field Drive List.
  4. In the field labeled Folder Box, type the path of the folder:
    1. \\fs.nd.edu\~genomics\Private\[your specific lab folder]
    2. User must enter the name of [your specific lab folder]. Typically, [your specific lab folder] is your PI’s name followed by “_Lab”.
    3. Example: \\fs.nd.edu\~genomics\Private\Smith_Lab
    4. Otherwise to obtain [your specific lab folder], contact us.
    5. Required: Select Connect Using a Different User Name. In the field User Name, enter ADND\[your ND net ID] and enter your ND Password.
  5. Click OK and then Finish.
  6. The mapped folder will appear in the File Explorer window.

For MAC Operating Systems OX10.5 and higher:

  1. Begin from the FINDER Window. From the top menu, click GO menu and then select CONNECT TO SERVER. A prompt window will open.
  2. In the field SERVER ADDRESS of the prompt window, type the path of the folder:
    1. smb://fs.nd.edu/~genomics/Private/[your specific lab folder]
    2. User must enter the name of [your specific lab folder]. Typically, [your specific lab folder] is your PI’s name followed by “_Lab”.
    3. Example: smb://fs.nd.edu/~genomics/Private/Smith_Lab
    4. Otherwise to obtain [your specific lab folder], contact us.

Viewing Your Results

To view your results, use one of the following available software:

Resources

DNA Sanger Sequencing Full Service Order Form

Sequencing Redo Policy

If the full service sequencing results fail completely or are not optimal (read length, etc), we will rerun the sample(s) for free.  The sample(s) and primer(s) (if applicable) need to be the exact ones that were attempted the first time.  If the quality does not change the second time around we will charge for the rerun.  However, if the reaction(s) work the second time there will be no cost.